← Home ← Back to /vg/

Thread 537994254

793 posts 272 images /vg/
Anonymous No.537994254 >>538046164
/bpsrg/ - Blue Protocol: Star Resonance General: Male Character Edition
CBT ends September 7, 2025 11:00 PM EST

>Download & key redemption
https://playbpsr.com/

>/bpsrg/ Resources, links & guides
https://rentry.org/bpsrg

>Guilds
Yotsuba | 13058
Never | 115389
Send a message when you apply mentioning /vg/ (Click guild leaders name/icon and message)
Applications are often flooded by randoms, if you can't apply, ask for a manual invite

>/vg/ World Channel
1488

>Trailers
https://youtu.be/uu-9bIIj0jE
https://youtu.be/Px_DtSUjs4s

>Meetups
End of CBT Meetup | Saturday 9/6/25 | 3 PM PST | Rooftop Garden (Ocean Hill Waypoint in Asterleeds)
Firework show at 4pm PST

Previous:
>>537972709
Anonymous No.537994325 >>537994404 >>537994423 >>537994449 >>537994496 >>538029890
NIGGA YOUR NAME APPEARS ON THE RIGHT SIDE OF THE BUBBLE TEXT WHILE ALL OTHERS ON THE LEFT SIDE. NIGGA WHY WOULD YOU EXPOSE YOURSELF LIKE THIS. HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAAHAHAHAA LOG LEAKING SHITTER
Anonymous No.537994326 >>537994485 >>538009046 >>538011237 >>538016443 >>538055626 >>538055770
[BPSRG MEETUP NOTICE] - LESS THAN 48 HOURS AWAY!
FINAL CBT MEETUP FOR FIREWORKS SHOW

>Title
Rooftop Fireworks Date - bpsrg

>Location
Ocean Hill Waypoint- Rooftop Garden

>Date and Time
Saturday, 3PM-5PM PST. Line TBD.

>Bringing a date
Please bring a date for the fireworks show if possible. Solo attendees are allowed.
Our resident leaker will screen record the entire meetup and shame every player who’s there alone without a date.
You have 48 hours to find a date.
A date is defined as one of the following:
a) a person you publicly claim as your date
b) a person you are seen holding hands with
c) a person you are seen in close proximity with who you move as a unit with

>Q: can i have more than one date?
yes. for the open relationshippers, you could go as a trio.

>Q: what if I don’t have a date?
No worries! The meetup is for EVERYONE. You can attend without one. However, many of us will be going with a date—and you will be shamed for being alone.

Your name will be:
>listed
>with portrait and card photos
>with personal space photo
>all other identifiers
>a screenshot of you standing alone will be obtained
>it will be caught on tape and uploaded unlisted to YouTube as video evidence.

Thank you.

Remember, this is a chance to incentivize you to find some new friends and get close to anons before the beta ends.
Treat it like prom. You don’t NEED to have any romance in your date. Just a partner to have a good night with.

Thank you and we look forward to seeing you all on Saturday.

-Yotsuba event organization team
Anonymous No.537994378
My f2 maid is going to sleep now. Please say good night & sweet dreams
Anonymous No.537994404
>>537994325
LMAO HE ACTUALLY EXPOSED HIMSELF
Anonymous No.537994405 >>537994485
REMINDER
THE BEACH FIREWORKS EVENT MEANS THAT OUR FINAL MEETUP IS GOING TO BE A DATE MEETUP
IF YOU DON'T HAVE A DATE:
>YOU /WILL/ BE NAMEDROPPED
>YOU /WILL/ BE CREEPSHOTTED
>YOU /WILL/ BE LAUGHED AT
CONFESS TO YOUR CRUSH, NOW!
Anonymous No.537994423
>>537994325
kenzou why are you leaking guild chat? you know YOU yourself the name in the chat appears on the right side while all others around you are on the left side? why would you expose yourself like this.
Anonymous No.537994432
>>537993958

>i was unironically defending kenzou this whole time but he really was doing the astroturfing ITT to boost his rep
Anonymous No.537994449
>>537994325
Benchy is kenzou i called it
give me officer now
Anonymous No.537994460
Kenzou just exposed himself as astroturfing himself what a fucking idiot lmao
Anonymous No.537994464 >>537994512 >>537994541
Certified mid-tier f3 seeking a +1 for the meetup! We can chat about some mundane topics! Or you could afk the whole time while sitting next to me! We could even hold hands! I am dead serious.
Anonymous No.537994485
>>537994326
>>537994405
>at least three anons have unironically confessed since the bullying started
BULLYING WORKS
GET A WIFE, NOW!!!!!!!
Anonymous No.537994496 >>537994519 >>537994592
>>537994325
I think you guys are taking it too seriously, he probably just thought it was funny and posted
Anonymous No.537994512
>>537994464
m2 here, add me ill accept when i log on tomorrow
Anonymous No.537994519
>>537994496
>talking in third person
Anonymous No.537994541 >>537995121
>>537994464
Post your f3 so I know who to DM
Anonymous No.537994553 >>537994661
Yes the one time I posted something I found funny I fucked myself up.
Anonymous No.537994592
>>537994496
>he probably just thought it was funny
it is a bit deranged the levels you go to defend him lmao
im so sure that’s something someone would post, someone who has proclaimed he never leaks logs or really even posts anything that isn’t screenshots of his character with others
this guy is legitimately just astroturfing and he got caught, it happens bro it’s shameless and embarrassing but you just gotta move on
Anonymous No.537994608
>guys it was funny not astroturfing myself, swear!
Anonymous No.537994639
>All the posts about Kenzou samefagging were true
top fucking kek
Anonymous No.537994661 >>537994773
>>537994553
you were on today's menu after all
Anonymous No.537994673 >>537994717
>mfw this guy is actually desperate and a samefag
dude what the fuck this is hilarious
Anonymous No.537994717 >>537994820
>>537994673
male players are so fucking pathetic
Anonymous No.537994751
Does anyone want to go to the fireworks show with a m2?
Anonymous No.537994773 >>537994904
>>537994661
Yep, sure am
Anonymous No.537994820 >>537994852 >>537994898
>>537994717
all male players should be what male characters were designed to be: invisible wallflowers
if a male character goes around yapping saying let me tank for you and please reach out to me if you need someone, that is the definition of sexpest
Anonymous No.537994852
>>537994820
sexpest means someone who bothers you for sex
Anonymous No.537994898
>>537994820
real male players dont even need to talk to attract pussy. they play the game and be giga chad aura.
Anonymous No.537994904
>>537994773
>Kenzou trying to downplay the fact that he got caught astroturfing and posted his literal own screenshot log leaks
buddy didn’t post a single game screenshot for days (that wasn’t astroturfing) and this is the first one where he actually got caught oml im in tears
Anonymous No.537995121 >>537995431
>>537994541
I'll drop a hint, but it should be easy. H
Anonymous No.537995129
https://poal.me/iebznt
https://poal.me/iebznt
https://poal.me/iebznt
Anonymous No.537995151
This shit is embarrassing but at the same time it's not that big a deal. Half the namedrops in this general are from people self namedropping themselves for clout.
Anonymous No.537995185 >>537995337 >>537995504
>gets caught
>a random anon suddenly mass replies and says “he was probably just trying to be funny”
>2 mins later Kenzou posts >that’s what I get for trying to post something funny for the first time
>2 mins later another anon replies (insinuating they’re Jiggy) and says you’re on the menu lol we’re all in on the joke

Is he just samefagging to save face or is Jiggy helping out? Either way this is the most blatant damage control I’ve ever seen lmao. Out of nowhere 3 posts from “different people” discussing how it was just for the funnies (when there’s been far saucier logs today and those logs were not funny at all, just implied innuendo)
Anonymous No.537995337 >>537995412
>>537995185
it was clearly kenzou trying to pass off as the leaker or some random in the guild who got jealous the kenGOD was getting some game with jiggy (Jiggy of all people lol), boosting his reputation as some sort of lady killer. he is quite popular with some of the ladies ill admit, but this gave me second hand cringe
Anonymous No.537995412
>>537995337
>still trying to astroturf
christ, you are mentally ill.
Anonymous No.537995431 >>537996112
>>537995121
Not interested Hamutitty. Can I get a +1 who’s not a whore involved with Toblerone please?
Anonymous No.537995496 >>537995790
I told you niggas this dude was obsessed with the thread and his rep. Idk why no one believes me when all you gotta do is browse the /bnsg/ archives to see his cringe shit on full display.
Anonymous No.537995504
>>537995185
>tfw you're just funposting from work and somehow you got ropped into big conspiracy
This is exhilarating
Anonymous No.537995520 >>537995554 >>537996118
can we get back to the main topic at hand:
FINDING A FUCKING DATE FOR THE MEETUP

i think we should put together a list of available anons of all genders and body types, so anons can put themselves up as available and other anons can go through the list and DM potential dates
Anonymous No.537995554 >>537996118
>>537995520
I just told my pet she's coming with me.
Anonymous No.537995646
Hamutitty, Hamushitty, Hamusthrowafitty, Hamusissy, Hamufifty(years of age), Hamugrippy

am i missing any other variants?
Anonymous No.537995654 >>537995725
I don't need a date I just wanna get milked
Anonymous No.537995687
>mfw I joined Never instead of Yotsuba
Anonymous No.537995725 >>537995876 >>537996006 >>537996215
>>537995654
refer to this list
Anonymous No.537995790
>>537995496
I don’t need to look at bnsg archives to believe you, anon.
I mean shit, the guy will bake a second bread 30 minutes later if he’s unsatisfied with the first bread then spam for us to move over like we have to use his bread.
I hate retards like that.
Anonymous No.537995876 >>537995956
>>537995725
How do people even know I'm a huge degenerate? I don't even talk in the GC or current chat
Anonymous No.537995956 >>537995989
>>537995876
You smell of cum
Anonymous No.537995981 >>537996059
Lurker here
Can i still get into the beta and download the game or not?
Still make it on time to help one of the lonely people show up not alone
Anonymous No.537995989 >>537996110
>>537995956
I've been eating healthy foods!
Anonymous No.537996006
>>537995725
I'm an apex degenerate!
Anonymous No.537996028 >>537996301 >>537996947
I doubt any of the male characters have a date for the meet up. You should just ask one of them and I guarantee you 100% they will say yes to the first person asking
Anonymous No.537996059
>>537995981
not unless someone has keys they haven't used yet, very unlikely at this point
Anonymous No.537996110
>>537995989
Try washing yourself from time to time then. Dried jizz is falling from your body
Anonymous No.537996112
>>537995431
Wrong
Anonymous No.537996118
>>537995520
>>537995554
this but i made it romantic because she's a sucker for that and i wanted to spoil her for doing something good recently
Anonymous No.537996215
>>537995725
I'm lewd for anons I like, but when I'm lewd I'm apex degenerate and WILL make my crush be at risk of dehydration.
Anonymous No.537996301 >>537996325
>>537996028
I'm male and I got a date, but I could talk my date into sharing me if it's the right anon asking.
Anonymous No.537996325 >>537996542
>>537996301
This is a fucking lie
Anonymous No.537996348
>being this much of a manwhore
Male players, everyone
Anonymous No.537996542
>>537996325
You're right, she'd probably encourage me to instead of needing to be asked because she's a fucking masochist, as long as she gets the main hugs/kisses when the fireworks go off.
Anonymous No.537996650
god i love shitposting and pretending to be a male character
Anonymous No.537996695 >>537996749 >>537996790 >>537996947
my crush better ask me out on the date or else
Anonymous No.537996749 >>537996878 >>537996947
>>537996695
why aren't you asking your crush out? are you crushing on a male and expecting him to bend the knee to societal traditions? that's just going to end with you getting cucked sis
Anonymous No.537996790
>>537996695
or else what huh? you not gonna ask her out anyway? oh nyooo
Anonymous No.537996878 >>537996947
>>537996749
Males always have to be the ones to ask. Us girlies expect to be treated like a princess so he should stop being so dense!!!
Anonymous No.537996947 >>537997069 >>537997213
>>537996695
this >>537996749

>>537996878
you're going to get cucked anon, at least one male is going to get asked out
maybe it won't even be kenzou or rob
it's practically guaranteed
don't sit there assuming you've won when you've done absolutely nothing

>>537996028
I can already imagine an anon seething later today
Imagine someone like scoozy or noir posting something like this
>I asked a male out to the fireworks festival and he told me he already had a date...
Anonymous No.537997050
Maybe pso2g was right about male characters after all...
Anonymous No.537997069
>>537996947
scoozy is going with pastel
Anonymous No.537997148 >>537997263 >>537997654
People roll male specifically to avoid e-dating.
Anonymous No.537997213 >>537997303 >>538000368 >>538000754
>>537996947
Girl characters here are to scared to ask males out on a date since we have been brainwashed that males have to be the ones asking.
Anonymous No.537997249
I just want to see him happy, okay?
Anonymous No.537997263
>>537997148
tough luck for them cause i want to edate a male and i will get one
Anonymous No.537997303
>>537997213
not only were the girls brainwashed that the males have to ask, they were also brainwashed that every single one isn't interested like the anon above you said
i bet most males would be willing to humor a girl and go "as a joke" if an anon asked them out and they were a bro that they played the beta with
Anonymous No.537997420
If a type 2 female asked me to go to the fireworks I would say yes...
Anonymous No.537997654 >>537997827
>>537997148
I've played male for 10+ years and I like edating, I prefer cool aesthetics over slutty ones and males get that the most.
It's also way easier for people to assume you're a top and not waste your time thinking you're a bottom, unless you play a certain kind of male characters.
Anonymous No.537997827
>>537997654
>It's also way easier for people to assume you're a top and not waste your time thinking you're a bottom, unless you play a certain kind of male characters.
god i fucking hate that shit, it's the whole reason why i don't immediately write off males because everyone has had to deal with a pushy retard trying to make you bottom despite saying you aren't interested
Anonymous No.537998187
I'm a male character who doesn't edate
Anonymous No.537998373 >>537998406 >>537998450
I'm a male character who just wants to pump and dump you
https://files.catbox.moe/2xxu8i.png
Anonymous No.537998406 >>537998621
>>537998373
me on the right but I'm an f1
Anonymous No.537998450 >>537999324
>>537998373
hint?...
Anonymous No.537998519
I'm a female character who would do the same to you.
Anonymous No.537998621
>>537998406
boring make a f2 then we can talk
Anonymous No.537998781 >>537999058 >>537999278
we really did get all the pso2g rejects...
Anonymous No.537998789
You are spineless.
Anonymous No.537998868 >>537998935
>Game dies in two days
>Will never see my crush again because they aren't planning to come back for release
. . .
Anonymous No.537998935 >>537999010
>>537998868
You sound like a little bitch.
Anonymous No.537999010 >>537999114
>>537998935
imagine never seeing the person you love again
Anonymous No.537999058
>>537998781
They will go back to their containment general in two days. These discord tranny tourists cannot live without drama after all.
Anonymous No.537999114 >>537999148
>>537999010
Then add them on discord or any other platform? Fucking retard.
Anonymous No.537999148
>>537999114
They don't use discord
Anonymous No.537999149 >>537999256
(You) will be my date to the meetup.
jk I'll be having all the fun in the world alone in a corner and you can't do anything about it
Anonymous No.537999256 >>537999616
>>537999149
Do you want to go with my m2?
Anonymous No.537999278 >>537999361 >>537999929 >>538001250
>>537998781
None of the popular ones joined yotsuba for whatever reason. They did play althoughbeit
Anonymous No.537999324
>>537998450
Its a shitpost sis. All our lewd males are asleep or in bed relaxing.
Anonymous No.537999361 >>537999605
>>537999278
>none of the popular ones joined yotsuba
You were saying?
Anonymous No.537999605 >>537999712 >>537999759 >>538000484
>>537999361
>you were saying
>only popular anons in screenshot are sipsoo and wakaba
neither one joined yotsuba what's your point?
Anonymous No.537999616 >>537999703 >>538000026 >>538000072
>>537999256
Depends...
Anonymous No.537999703
>>537999616
my friend who caves way to fast...
Anonymous No.537999712
>>537999605
>wakaba
>popular
LMAO
Anonymous No.537999759 >>537999816
>>537999605
Sips was never popular, she just had one or two obsessed schizos
Anonymous No.537999816
>>537999759
that's me! both of them!
Anonymous No.537999817 >>538033327
Uuuuh my dancho, so fragrant...
Anonymous No.537999929 >>538000406
>>537999278
whos popular anyway, Only K, R and S comes to mind, and out of these 3 only K got into the beta afaik
Anonymous No.538000026 >>538000682
>>537999616
you're in the wrong guild.
Anonymous No.538000072 >>538000682
>>537999616
Depends on what?
Anonymous No.538000368
>>537997213
could have been me and karina...
Anonymous No.538000406
>>537999929
None of them were popular when it mattered.
Anonymous No.538000484
>>537999605
wakaba is the original clique fag. he played with his cumrags.
Anonymous No.538000682
>>538000026
Yotsuba is/was full
>>538000072
Post your m2
Anonymous No.538000707 >>538000960
Thanks for all the tier lists last thread. It gave me a moderate ego boost which will surely be crushed in the next 5 - 15 hours.
Anonymous No.538000754
>>537997213
potential yotsuba for this feel?
Anonymous No.538000960 >>538001004
>>538000707
gonna crash your lovense
Anonymous No.538001004
>>538000960
Can that happen? I've never had that happen..
Anonymous No.538001250
>>537999278
>None of the popular ones joined yotsuba for whatever reason
why would anyone join yotsuba LMAO y'all a bunch of schizo snakes
Anonymous No.538002245 >>538002567 >>538003045
Remember to ask your crush on a date for the meet up! Only one day left!
Anonymous No.538002567 >>538002640
>>538002245
Four anons have asked out four crushes. Keep pumping those numbers up bros.
Anonymous No.538002640 >>538003478
>>538002567
I hope my male character crush asks me out...
Anonymous No.538002904 >>538003668
They said no. I want to die
Anonymous No.538003045 >>538003358
>>538002245
but i'm going to be busy gooning...
Anonymous No.538003358 >>538003417 >>538003446
>>538003045
>Not gooning with your crush
ngmi
Anonymous No.538003417
>>538003358
>Not gooning with every anons crush
ngmi
Anonymous No.538003446 >>538003485
>>538003358
i have like... 40 doujins saved that i want to look at so i'm going to do that... alone! :3
Anonymous No.538003478 >>538003574
>>538002640
I am going to ask out every male. You are getting cucked sis.
Anonymous No.538003485 >>538003746
>>538003446
>Not streaming it over discord so you can goon with your crush
ngmi
Anonymous No.538003574
>>538003478
Lies... You are just saying this to make me feel bad.
Anonymous No.538003612 >>538003758 >>538003826 >>538003850 >>538003939
||I don't like the hornyposters anymore because I realized that some of you maggots are keylets.||
Anonymous No.538003668
>>538002904
Wish it was me..
Anonymous No.538003746 >>538003848
>>538003485
good idea! i'll keep it in mind if i ever make a friend like that
Anonymous No.538003758 >>538003916
>>538003612
>he can't spoiler
how new
Anonymous No.538003826 >>538003939
>>538003612
||This a lot of them don’t seem to capable of putting together full sentences in an ERO situation. And also seem fucking desperate often.||
Anonymous No.538003848 >>538004114
>>538003746
hey...
https://litter.catbox.moe/dpcjczve9alrdw06.jpg
Anonymous No.538003850 >>538003916
>>538003612
cute..
Anonymous No.538003916
>>538003758
||>he can read ERP detection text||
Hey...
>>538003850
Hi Hi ||Hi||
Anonymous No.538003939
>>538003612
>>538003826
||What the fuck is a sentence?||
Anonymous No.538004036 >>538004103
||is this the new meme now? Pretending this is functional spoiler text? You guys are so irony poisoned it's like a circus here.||
Anonymous No.538004101 >>538004175 >>538004210
I don't know how you fuckers can write whole novel while ERPing and doing it for real. At some point I get horny enough that writing more than 2 sentences is a struggle.
Anonymous No.538004103
>>538004036
||Honking your nose and running away||
Anonymous No.538004114 >>538004228 >>538004384
>>538003848
hi! https://litter.catbox.moe/22k4r443512olluu.png
Anonymous No.538004175
>>538004101
I just usually text fuck with whatever GAM is on the other end of the ocean. Written ERP can be fun but most people just wanna get off, so doing some short, sweet stuff is ideal.
Anonymous No.538004210
>>538004101
||honestly most people don't mind waiting for slow typers as long as you aren't the type of fag who takes 10 minutes to say 8 words||
Anonymous No.538004228 >>538004359 >>538004367
>>538004114
wanna? https://litter.catbox.moe/8dnbl73gdmy35o7g.jpg
Anonymous No.538004359 >>538004453 >>538004468
>>538004228
Meet at line 9 on the dock
Anonymous No.538004367 >>538004468
>>538004228
i wasn't planning on being a horny lewdie just yet, sorry! still have things to do in the morning first :3
Anonymous No.538004384 >>538004671
>>538004114
TEXANS, DO NOT OPEN!
Anonymous No.538004453
>>538004359
Can I watch...
Anonymous No.538004468 >>538004667 >>538004671
>>538004359
You must post something lewd first so I know you are serious

>>538004367
Maybe next time then :3
https://litter.catbox.moe/o34de1jp4qwujkrp.jpg
Anonymous No.538004667 >>538005068
>>538004468
Meet me or don't, you sound like that keylet bugging people for lewds.
I am leaving with whoever shows up first
Anonymous No.538004671 >>538004785
>>538004384
woe, witness loli upon ye!

>>538004468
we have to do it next time for sure without failure...

https://litter.catbox.moe/hly0uu65ux8snbvb.png
Anonymous No.538004773 >>538004784
i'm jerking off desu
Anonymous No.538004784
>>538004773
Why would you do that…
Anonymous No.538004785 >>538004949
>>538004671
Next time indeed can't wait, i'll have to use my time now
https://litter.catbox.moe/m1swh9bbf76ew2wd.jpg
Anonymous No.538004949 >>538005065
>>538004785
good luck pumping it, stroking it and blowing a load :3
Anonymous No.538005065 >>538005196 >>538005351
>>538004949
I'll edge and build up a good load in your stead.
https://litter.catbox.moe/6f736w2amzpkkr4z.jpg
Anonymous No.538005068
>>538004667
I didn't realize you were a degenerate... glad we could add each other
Anonymous No.538005196
>>538005065
me as the ona
Anonymous No.538005351
>>538005065
ganbare!~ ganbatte!~ mwah!~ mwah!~ one, two, three, four, pump out a sticky load!~ https://litter.catbox.moe/4n8bsw0y4a7ipryc.jpg
Anonymous No.538005421 >>538005553
what no pussy does to a mothafucka
Anonymous No.538005514 >>538005617 >>538005731 >>538005769
I saw the 2 that met up..
Anonymous No.538005553
>>538005421
I’m busy getting treated like one. We’re not the same.
Anonymous No.538005609 >>538005727 >>538005889 >>538006008
I cheat on my boyfriend so he grows as a character...
Anonymous No.538005617
>>538005514
post them
Anonymous No.538005647 >>538005710
||Meetups > thread discord burners||
Anonymous No.538005710 >>538005776
>>538005647
i goon on my main discord
Anonymous No.538005727 >>538006008
>>538005609
I don’t remember making this post…
Anonymous No.538005731
>>538005514
Meet me at weaver shop and spread the deets?
Anonymous No.538005769
>>538005514
Inb4 anon namedrops people who aren't even online
Anonymous No.538005776
>>538005710
Holy BASED
Anonymous No.538005889 >>538006008 >>538006049
>>538005609
This but my girlfriend. And she watches!
Anonymous No.538006008 >>538006132
>>538005609
>>538005727
>>538005889
hot... i wish i had a gf that would cuck me...
Anonymous No.538006049 >>538006165
>>538005889
I need a cuckquean gf...
Anonymous No.538006080 >>538030326
||I fucking hate some of you gooners.||
Anonymous No.538006132
>>538006008
I’d build you up only to shatter your heart. Don’t wish for something you’ll regret anon
Anonymous No.538006165 >>538006234
>>538006049
hiii~
Anonymous No.538006168 >>538006241 >>538006306 >>538006406
I found someone I want to groom into being a sextoy for my bf..
Anonymous No.538006234 >>538006374
>>538006165
hey do you wanna watch me plap other girls?
Anonymous No.538006241 >>538006490
>>538006168
Hint?
Anonymous No.538006306 >>538006490
>>538006168
Who is it…
Anonymous No.538006374 >>538006410
>>538006234
yes please...
Anonymous No.538006406
>>538006168
Me too but I do not think she would want that, I think she wants to get a personal bf.
Anonymous No.538006410 >>538006778
>>538006374
Give me a name so I can DM...
Anonymous No.538006490 >>538006567
>>538006241
>>538006306
A submissive little f1 of course..
Anonymous No.538006510
>NA hours
>Drama everywhere
>EU hours
>ERP everywhere
Anonymous No.538006567 >>538006618
>>538006490
Do you have any idea how little that narrows it down!
Anonymous No.538006618 >>538006743
>>538006567
That's the point! I'm not sharing her with your harlots
Anonymous No.538006743 >>538006990
>>538006618
Is it meeee?
Anonymous No.538006778 >>538007163 >>538007464 >>538008337 >>538008396 >>538059087 >>538059248
>>538006410
well... it's a bit embarrassing to put myself out there in that way, you know... but if you see me running around or at that one meetup coming up, at least you'll be aware of who it is :3
Anonymous No.538006990 >>538007297
>>538006743
Yes!
Anonymous No.538007163 >>538007282
>>538006778
nevermind you are kind of ugly
Anonymous No.538007282
>>538007163
phew, thank goodness...
Anonymous No.538007297
>>538006990
Yay :3
Anonymous No.538007464 >>538009060
>>538006778
mommy...
Anonymous No.538008118
rip...
Anonymous No.538008337 >>538009060
>>538006778
biofem coded character
Anonymous No.538008396 >>538009060
>>538006778
cool character
Anonymous No.538009023 >>538009213 >>538009804 >>538023148 >>538025158
I want to spend every waking moment of my entire life balls deep inside of effy
Anonymous No.538009046
>>537994326
>Bring a date
... This is very complicated~(◕︿◕)
I do not believe I qualify for the event.
Anonymous No.538009060 >>538021751
>>538007464
>>538008337
>>538008396
t...t...t...t...thanks...
Anonymous No.538009213
>>538009023
It would be the other way around
Anonymous No.538009804
>>538009023
That's not at all the mood lately
Anonymous No.538010540 >>538012748
Why are people stressing out over a date? Just pick up a t1. They're literally free. No one is going to stop you
Anonymous No.538010786
I can't even make it to the meetup because of timezones, this sucks
Anonymous No.538011237 >>538011328
>>537994326
Why are you weirdos always trying to turn /vg/ into a highschool dating scene
Anonymous No.538011328
>>538011237
trying to experience even a fraction of shit they've missed out when growing up
Anonymous No.538012586
Do you all miss me?
I miss you all....
please come back...
Anonymous No.538012748 >>538015498
>>538010540
it really feels like everyone in the general only gives a shit about loli cunny t1 females unless the t2/t3 is a known popular namefag from another mmo general
Anonymous No.538013967 >>538014014
My male character gets namedropped often, yet he will be going alone to the fireworks meetup. I have a girlfriend and even if things aren't going well I will remain loyal
Anonymous No.538014014
>>538013967
I'll change that
Anonymous No.538014537 >>538014880 >>538014921 >>538022138
meeting in game is boring let's go straight to discord
Anonymous No.538014880
>>538014537
Hmmm no
Anonymous No.538014921
>>538014537
basic ass /trash/ nigga sybau
Anonymous No.538015498
>>538012748
Nonnys are down bad for little girls~
Anonymous No.538015708 >>538015976 >>538016801 >>538021595
Why did scoozy change color
Anonymous No.538015976
>>538015708
Diversity hire
Anonymous No.538016443
>>537994326
>Date and Time Saturday, 3PM-5PM PST
Literally the time i go to work, kek. Have fun for me sisters
Anonymous No.538016801 >>538016876
>>538015708
Because hes a dude and he doesnt care about you bro
Anonymous No.538016876 >>538017017
>>538016801
No...
Anonymous No.538017017
>>538016876
Are you trying to groom spooky to be girly or some shit lil nigga?
Anonymous No.538018624 >>538022138 >>538022457 >>538022854
now that we are nearing the end of the playtest, share what you liked/didnt like with an invitelet, I only trust anons for game opinions.
Anonymous No.538018680
My blue protocol is the zapp brannigan of bpsrg
Anonymous No.538019285
Best swimsuit?
Best maid outfit?
Best weeb outfit?
For an f2...
Anonymous No.538020754 >>538020804 >>538020867
>last meetups are date meetups
I will simply not go
Anonymous No.538020804
>>538020754
I will wallflower like I have always done
Anonymous No.538020867 >>538021029
>>538020754
It's not an actual date meetup, that's just thread being thread.
It's a regular meetup where we all go and just relax on the last day, nothing more.
Anonymous No.538021029 >>538021316
>>538020867
who the fuck is we? I’m going with a date and I know a handful of others who will
Nothing wrong with going alone ofc, but nothing wrong with having a date
Anonymous No.538021223
if you don’t bring a date you’re a loser
dates can be friends, just go with a +1
going alone means you’re a wallflower outcast
Anonymous No.538021316
>>538021029
I'm not saying you can't go with a date, I'm just saying it's a regular meetup and a date is not needed or even mentioned in the original post.
Anonymous No.538021369
>>537978538
>put in footjob tier
good job on paying attention to the fact that the only shoes I wore this beta was when I got the commanders outfit
Anonymous No.538021419 >>538021503 >>538021781
>go on a date with another dude
or
>get called a loser by the ERP squad
choose wisely anon
Anonymous No.538021503 >>538022079
>>538021419
Just ask Scoozy out.
Anonymous No.538021595
>>538015708
to what
Anonymous No.538021751 >>538022138
>>538009060
you can't show me blanc and then not have your character look like blanc
Anonymous No.538021781
>>538021419
3rd option
dont go to the meeting and just chill with randoms elsewhere
Anonymous No.538022052
>>OMG GUYS LOOK AT THIS EMBAAARRRRASSSING THING SOMEONE SAID TO MUCH GOD I HAVE TO DEAL WITH THIS ALLLLLLLLLL DAY
Anonymous No.538022079 >>538022229
>>538021503
Scoozy can't be a man! She can't be!
Anonymous No.538022138
>>538014537
good opinion

>>538018624
i've only done the story and not much else at all so keep that in mind but i think the foundations of the game are good, it just needs to be polished and improved upon a lot more. there's a lot of untranslated stuff (like when i did the patrol leisure thing, the text was entirely in chinese in that reward box that pops up on the left side of the screen) as well as mistranslations that make it all feel extremely janky, the ui also isn't the best either but i can see why it is the way it is, i don't like the battle imagine naming it sounds unnatural but i don't know what name they could've gone for instead... just a lot of janky stuff translation wise i guess? will have to see about the dressup portion of the game, i don't like how hairstyles and outfits are locked behind opening up my wallet...

>>538021751
i'm not good at the character creator in this game honestly, sorry!
Anonymous No.538022229
>>538022079
Got some bad news bro
Anonymous No.538022232 >>538022406 >>538022497 >>538024380 >>538024612 >>538049895
whys dating and e-relationships always the endgame for mmo generals?
Anonymous No.538022406
>>538022232
i dont understand either
is a damn game not a dating app
Anonymous No.538022457
>>538018624
i've liked the gameplay so far with ice mage, the life skill system needs an overhaul and the overuse of menus when they take up your whole screen is obnoxious
Anonymous No.538022497
>>538022232
i was horny but now I'm bored and regret starting one
Anonymous No.538022526 >>538022589 >>538023273 >>538023347 >>538023554
why can't I find this expression in game? it's not the teasing face
Anonymous No.538022589
>>538022526
Anonymous No.538022854
>>538018624
There's too little unbound luno and buns rose orb generation. Especially for how the high minimum prices are for things.
Dyeing is extremely ass. I highly recommend making your character have a defined color palette and sticking to it.
There needs to be a few more good outfits available for f2p.
Imagine crafting IS going to kick some people's asses with how jewy it gets
Anonymous No.538023148 >>538024517
>>538009023
Same but the other way around
Anonymous No.538023273
>>538022526
In the JP version it would come with that emote, but some of the emotes don't use their expressions in SR, even though they do in the character creator, game is jank.
Anonymous No.538023347
>>538022526
Female kenzinger
Anonymous No.538023554
>>538022526
close enough, i will now reer to you as little sister, even if we will never meet.
Anonymous No.538023619 >>538023721 >>538023779 >>538024227
how do i get my dyes
Anonymous No.538023721 >>538023779 >>538024227
>>538023619
Honestly the best route is grabbing the packs when they show up in the mystery shop
Anonymous No.538023779 >>538024104 >>538024227
>>538023619
*more
fuck
>>538023721
shit
Anonymous No.538024009 >>538024161 >>538024729
Anonymous No.538024104 >>538024227
>>538023779
It's hard out here in these streets. You can craft them at 25 stamina a piece, but remember that you need 12 PER channel you're changing. So it's easily going to 48+ dyes for an outfit, or three whole days worth of stamina. Buying them from players is also gonna be like 140k for all that. It's so ass.
Anonymous No.538024161 >>538024898
>>538024009
>Turning even gayer
Nice
Anonymous No.538024227 >>538024382
>>538024104
>>538023779
>>538023721
>>538023619
nta but fuck this stupid dye shit i'm going to make a pale black haired goth so i don't need to deal with it
Anonymous No.538024380 >>538024465
>>538022232
My end game is mating with (You).
Anonymous No.538024382
>>538024227
You still need dyes for making shit black or white, sadly. But that'd say least be a strat to not feel compulsion to change often. Genuinely, I recommend picking a color scheme and sticking to it.
Anonymous No.538024465 >>538024596
>>538024380
but im a boy
Anonymous No.538024517 >>538025158 >>538025312
>>538023148
Same but I want to spend every waking moment of my entire life balls deep inside of effy while effy spends every waking moment of his entire life balls deep inside of anon
Anonymous No.538024596
>>538024465
Just pretend you're a girl for 1-2 hours okay?
Anonymous No.538024612
>>538022232
MMO generals have enough love triangles, schizos, and cucking to be an Aquarion season.
Anonymous No.538024729 >>538024898
>>538024009
Getting ready for transition?
Anonymous No.538024898 >>538025729
>>538024161
>>538024729
*turns into a car*
Anonymous No.538025135 >>538025168 >>538025345
I can't believe how the average player in this game is either a teen or a groomer
Anonymous No.538025158 >>538025274 >>538025281 >>538025545
>>538009023
>>538024517
hope you like watching effy shove her futa cock in mofu's blown out pussy
Anonymous No.538025168
>>538025135
That's literally every online game these days
Anonymous No.538025274
>>538025158
Hey, I haven't plapped here yet! >:(
Anonymous No.538025281 >>538025324 >>538030862
>>538025158
>tfw love effy
>tfw hate mofu
Anonymous No.538025312
>>538024517
This is agreeable
Anonymous No.538025324 >>538025504 >>538030862
>>538025281
literally me
Anonymous No.538025345 >>538025541
>>538025135
age restrictions can't come soon enough.
Anonymous No.538025504 >>538025594
>>538025324
they will have a fight sooner or later
Anonymous No.538025541
>>538025345
LONDON?
Anonymous No.538025545
>>538025158
>cringe top
dropped
Anonymous No.538025594 >>538025720
>>538025504
and then have mentally ill makeup sex..
Anonymous No.538025720 >>538025869
>>538025594
kill yourself
Anonymous No.538025729 >>538025869
>>538024898
*Drives you for an hour*
Get used bitch
Anonymous No.538025869 >>538025973 >>538026159
>>538025720
He took me near the watermelon. What do you think this means?
>>538025729
Thanks for filling me up with fuel..
Anonymous No.538025973 >>538026023 >>538026089
>>538025869
when are you two going back to xivg
Anonymous No.538026023
>>538025973
Will you also go back to the game you played before this?
Anonymous No.538026089 >>538026214
>>538025973
When the CBT is over & then back again when it launches
Anonymous No.538026159 >>538026374
>>538025869
It wasn't fuel it was my cock, haha, idiot
Anonymous No.538026214 >>538026286 >>538026359
>>538026089
when are you two quitting this game for good tho
Anonymous No.538026286
>>538026214
>anon will soon understand that people can play multiple games
Anonymous No.538026359
>>538026214
If I stop having fun. I only play XIV to take screenshots & to run deep dungeons, occasionally raid if I coerce someone into joining me
Anonymous No.538026374 >>538026569
>>538026159
Aha that would be terrible if you did it same time tomorrow, like..so bad..
Anonymous No.538026413 >>538026663 >>538026668
What's the fastest way to get 1.2k soulbound orbs?
Anonymous No.538026569 >>538026604
>>538026374
Sure faggot
Anonymous No.538026604 >>538026983
>>538026569
thanks, love you..
Anonymous No.538026663
>>538026413
buy them from whales with 600k unbound lunos
Anonymous No.538026668
>>538026413
Anonymous No.538026868
good morning
Anonymous No.538026983
>>538026604
Uh cute faggot!
Anonymous No.538027784 >>538027804 >>538027927
Should I buy a vr headset?
Anonymous No.538027804
>>538027784
No
Anonymous No.538027843 >>538028231
so is Mastery actually kinda bad on Shield Knight despite being a recommended stat?
i ran the moonrunes through yandex and if i'm understanding the rough translation correctly, all it does is boost how much shield you generate or what percentage of damage the shield is allowed to absorb on hit...

it sounds really bad and counterproductive
Anonymous No.538027927 >>538028353
>>538027784
do you want to give up on life, regularly go to irl meetups with other fat ugly hairy neckbeards and trannies in florida and netherlands, do drugs (fent and hrt usually) and have imaginary vr sex all the time filled with drama? sure join vrchat and /vrg/ on vg and trash
Anonymous No.538028028
Anonymous No.538028231
>>538027843
a % inside a % is always bad
Anonymous No.538028353 >>538028435
>>538027927
Is it really just going to be ugly people and druggies?
Anonymous No.538028435 >>538028557
>>538028353
you're not going to get cute looking twitter onlyfans femboys or women with 100k followers showing up to those vrchat fuckmeets irl
Anonymous No.538028557
>>538028435
anyone with a modicoom of good looks, heck, average look will try to avoid creeps
Anonymous No.538028743
>tfw in good shape and handsome
>also autistic and nervous 99% of the time
Anonymous No.538029890 >>538030402
>>537994325
>Have a funny chat interaction
>Share it
>Immediately blasted for "leaking logs"
This wouldn't happen to anyone but Kenzou
Anonymous No.538029931 >>538031527
Nap time..
Anonymous No.538030186
Games dead, jim
Anonymous No.538030326
>>538006080
>Discord spoilers
Self deprecation isn't funny
Anonymous No.538030402
>>538029890
The crown is heavy, ese
Anonymous No.538030663
Any news as to what patch we're launching with?
Anonymous No.538030862
>>538025281
>>538025324
>he’s not hate fucking one whilst smoochmaxing the other
ngmi
Anonymous No.538030897 >>538030976 >>538031043 >>538031123
Should I ask Scoozy out on a date for the last day of CBT?
Anonymous No.538030976
>>538030897
Sure, why not
Anonymous No.538031043 >>538031291
>>538030897
ask the magic 8 ball
Anonymous No.538031123
>>538030897
What’s the worse that can happen? He says no and walks off with Ken?
Anonymous No.538031291
>>538031043
It's over. I will now move on forever.
Anonymous No.538031301 >>538031432 >>538031478 >>538031602 >>538031781 >>538033957 >>538034740
Serious question is sex with femboys even any good?
Anonymous No.538031314
Should I ask Rob out?
Anonymous No.538031318 >>538031431 >>538031556
who will be my date? >_<
Anonymous No.538031431
>>538031318
Males should be making the move.
Anonymous No.538031432
>>538031301
yes!
Anonymous No.538031478
>>538031301
If you don’t mind the occasional mental breakdown then yeah, it’s the best
Anonymous No.538031527 >>538031621
>>538029931
Where do you get that hat?
Anonymous No.538031556
>>538031318
My queen, you deserve only the best so you should go for Male T2 or T3.
Anonymous No.538031602 >>538032430
>>538031301
That depends. Hung tops or small dick bottoms?
Anonymous No.538031621 >>538032178
>>538031527
this months monthly pass gives it
Anonymous No.538031781 >>538032357
>>538031301
I had sex with a racist white femboy and it was pretty okay.
Anonymous No.538032178
>>538031621
Time to buy the monthly pass on release..
Anonymous No.538032297 >>538032364
i'm hiding that femboy post
Anonymous No.538032357
>>538031781
Best kind
Anonymous No.538032364
>>538032297
post your bussy now
Anonymous No.538032430
>>538031602
Hung bottoms. Wanna see it flop around uselessly
Anonymous No.538032464
i hid that post too
Anonymous No.538032580 >>538032771 >>538032914
maybe stop larping as a nazi while wearing cat ears and you wont attract thugs
Anonymous No.538032771 >>538032826 >>538032934 >>538033236
>>538032580
How do I attract a gameplay wife?
Anonymous No.538032826
>>538032771
You don't.
Anonymous No.538032914
>>538032580
I want a little faggot like this tho
Anonymous No.538032934 >>538033265
>>538032771
you dont, she will be to busy grinding the game to socialize.

hey...
Anonymous No.538033236
>>538032771
invite gameplay maidens to party. Talk about other games. Have a sense of humor/wit. You gotta win via the mere exposure effect with those types.
Anonymous No.538033265
>>538032934
Fag.
Anonymous No.538033314
bpsrg hood takeover?
Anonymous No.538033327
>>537999817
Danchou feet!
Anonymous No.538033450 >>538033649 >>538033753 >>538033810 >>538033867 >>538034717 >>538035015 >>538036247 >>538038431 >>538038737
Thoughts?
Anonymous No.538033649
>>538033450
Time to make a min height f2
Anonymous No.538033753
>>538033450
I want a male minheight boyfriend!
Anonymous No.538033810 >>538034772
>>538033450
m2 or m3 for my f2
Anonymous No.538033819 >>538037157
Friendly reminder not to shoot the messenger: Seio is only the paperboy, treat him kindly
Anonymous No.538033867 >>538038431
>>538033450
>-10
tiny head ass niggas
Anonymous No.538033957
>>538031301
no matter how much they clean before fucking, there will always be a hint of smell
Anonymous No.538033984 >>538034602
i lost my sprout...
Anonymous No.538034602 >>538034695
>>538033984
but you bloomed with beautiful petals...
Anonymous No.538034695
>>538034602
y-you too
Anonymous No.538034717 >>538036247 >>538038431
>>538033450
it's not lined up correctly..
Anonymous No.538034740
>>538031301
If you have a proper bottom femboy that can into prep yes.
Anonymous No.538034747
Angry bread eating
Anonymous No.538034772 >>538034956
>>538033810
Only if you're a -10 f2
Anonymous No.538034956 >>538037517
>>538034772
I'm a -7...
Anonymous No.538035015 >>538035756 >>538035869
>>538033450
I'm going to make a type 3 male relieve all type 1 females from their sexual tension
Anonymous No.538035756 >>538035950
>>538035015
>he doesn't know
Anonymous No.538035869 >>538035982
>>538035015
Nobody is interested in males, and if they are, then its 1 and 2
Anonymous No.538035950
>>538035756
Alright, then I'll make a type 3 female relieve all type 1 females from their sexual tension
Anonymous No.538035982
>>538035869
Maxheight m2 for my minheight f2
Anonymous No.538036062 >>538036289
>8 hours later at 400 posts
why did this general die in 2 weeks
Anonymous No.538036145 >>538036324 >>538036353 >>538036687
Dont feel like logging in after being ranked as extremely annoying and ugly last night... enjoy the rest of the cbt guys
Anonymous No.538036247 >>538036684 >>538038431
>>538033450
>>538034717
fix'd
Anonymous No.538036250
But I’m a maxheight f2…
Anonymous No.538036289
>>538036062
It's the last two days of the beta, people dont feel like playing when its getting wiped in an instant.
Anonymous No.538036324
>>538036145
auti...
Anonymous No.538036353
>>538036145
:c
Anonymous No.538036397
Don't hole up in guild center, go outside!
Anonymous No.538036684
>>538036247
and just for fun
Anonymous No.538036687 >>538036793
>>538036145
auti doesn't type sloppily like that imposter
Anonymous No.538036731 >>538036985
Definitely going shield knight on launch.
Heavy guardian kind of blows desu. Not only does it fall behind but also because the sword magnet spike looking thing looks so fucking dumb and clashes with fashion, sword and board looks way aesthetically more pleasing for any outfit.
Anonymous No.538036793
>>538036687
Add that to the list of disparagements... I'm not autistic...
Anonymous No.538036985
>>538036731
I was going to go WK and SK as my alt for helping anons
Anonymous No.538037075 >>538037101
Date?
Anonymous No.538037101 >>538037304
>>538037075
nah ur cring
Anonymous No.538037157 >>538037321 >>538037429 >>538037574
>>538033819
he's also an enormous schizo from xivg
Anonymous No.538037304
>>538037101
Anonymous No.538037321
>>538037157
just like the rest of all your boogeymen right?
Anonymous No.538037429
>>538037157
Hate seeing someone get exposed for something WE ALL do
Anonymous No.538037517
>>538034956
That can be ok
Anonymous No.538037574 >>538037821 >>538037915 >>538038052 >>538038106 >>538038258
>>538037157
>he
spill the tea my knower nigga
Anonymous No.538037821
>>538037574
has no style
Anonymous No.538037915
>>538037574
he has no grace
Anonymous No.538038052
>>538037574
this yotsuba has a funny face
Anonymous No.538038106 >>538038203 >>538039193
>>538037574
he's a gay pedophile that pretends to be a fujo
Anonymous No.538038203
>>538038106
that's not tea that's a description of 90% of the guild
who is it
Anonymous No.538038258
>>538037574
he only eats fries and hes related to michael kumo
Anonymous No.538038431
>>538033450
>>538033867
>>538034717
>>538036247
i believe -5 should have the best head/body ratio
Anonymous No.538038486 >>538038537 >>538038749 >>538038765 >>538038786 >>538038790 >>538038826 >>538039123 >>538039571 >>538040085 >>538040597 >>538042531 >>538042698
Yotsuba's t2 and t3 females. Rate em, claim em
Anonymous No.538038537
>>538038486
CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT
Anonymous No.538038737
>>538033450
>minheight f2s are more mature looking maxheight f1s
cute... if only character deletion wasn't timelocked, i could play around with this
Anonymous No.538038749
>>538038486
Sex with Pygo while she makes fun of my penis
Anonymous No.538038765
>>538038486
It was nice of Newt to leave the guild and not spoil the curve for everybody else.
Anonymous No.538038786
>>538038486
They all use the more squinty eyes
Anonymous No.538038790
>>538038486
>Cat
>Hamu
>Effy
>oat
>Cylfina
>Fely

all peak
Anonymous No.538038826
>>538038486
Butts!
Anonymous No.538039017
Do nyot pick me...
Anonymous No.538039123
>>538038486
I get the feeling Cat would ride the wildest dick but also be so many red flags.
Anonymous No.538039176 >>538040821 >>538040996
t3 females be like -_-
Anonymous No.538039193 >>538039363
>>538038106
next you're gonna say miyu isn't a big black dude lol..
Anonymous No.538039257
Seia has always been my favorite Blue Archive character. But I decided to use the name of a different one instead.
Anonymous No.538039363
>>538039193
do we need to do this every day lmao you insecure whitebois in this thread wont be happy unless everyone is pastey with a barely average cock

black men exist
women exist
4chan isnt your yacht club
Anonymous No.538039504 >>538039538
I hate my stupid fucking whore wife so much.
Anonymous No.538039538
>>538039504
Same I hate Pygo too
Anonymous No.538039571
>>538038486
Dibs on the short ones
Anonymous No.538039574
I love my stupid whore wife so much.
Anonymous No.538039612
I wish I had a wife that hated me for being a whore
Anonymous No.538039634
i love my fat wife so much
Anonymous No.538039792 >>538040037
Im gonna fuck that little gremlin so hard she gets hiccups
Anonymous No.538039875
is it me
Anonymous No.538040037
>>538039792
Tok, Bossu, Lico, Miyu, Cocona, or Jiggy.
Anonymous No.538040085
>>538038486
For me, it's Yuuna
Anonymous No.538040198 >>538040564
Anonymous No.538040564
>>538040198
Stop bragging about your loose hole
Anonymous No.538040597
>>538038486
Butts is the best.
Anonymous No.538040821 >>538040875 >>538049817
>>538039176
-_-
Anonymous No.538040875 >>538041025
>>538040821
this is a good -_-er
Anonymous No.538040996
>>538039176
There's a serious case of sameface
Anonymous No.538041025
>>538040875
with the hard r?!
Anonymous No.538041118 >>538042072
nobody likes my f2...
Anonymous No.538041289 >>538042072
I have a mediocre f2 but I’m really slutty and that makes up the difference
Anonymous No.538042072
>>538041118
>>538041289
i like your characters
Anonymous No.538042226 >>538042363
Hey hey~ namedrop me again~ I'm bored
Anonymous No.538042363
>>538042226
No nigga go jerk off or something.
Anonymous No.538042489 >>538042972
i'm gameplaying...
Anonymous No.538042518 >>538042918 >>538043369 >>538043532 >>538043673 >>538043872 >>538044545 >>538047394
/bpsrg/ males:

>don’t have a date for Saturday’s fireworks show
rob - Male 3.
seio - Male 2.
dude - Male 3.
anta - Male 1.
Maku - Male 3.
reon - Male 3.
silolliallik - Male 3.
axemented - Male 3.
Male nym - Male 3.
oni - Male 1.
funkyfrank - Male 3.
darius - Male 3.
jean - Male 1.
senny - Male 2.
ginga - Male 1.

>have a date
Kenzou
creep
Grung
Cappu
Kikin
Isa
Kato

make sure to ask out your date before they all get taken!!
You don’t want to show up to the meetup alone and in a corner, do you?
Anonymous No.538042531 >>538042670
>>538038486
Even including Blint shows how bad this general is.
Anonymous No.538042670
>>538042531
there's nobody named blint there
Anonymous No.538042698 >>538043069
>>538038486
>scoozy’s face kinda falls flat outside of screenshots
what the fuck lol
is she really carried by the meowlix vault hairstyle that costs 1mil luno
Cat unironically looks 10/10
Anonymous No.538042918
>>538042518
you will not catch me attending with a male date lol i ain’t gay
Anonymous No.538042972
>>538042489
nevermind...
Anonymous No.538043069
>>538042698
Idk I think it looks more youthful compared to the -_-
Anonymous No.538043305
-_-
Anonymous No.538043369 >>538047083
>>538042518
rob - Male 3.
>boring personality extremely boring design
seio - Male 2.
>would, but probably taken
dude - Male 3.
>would, but generic
anta - Male 1.
>would, very cute green eyes
Maku - Male 3.
>ugly
reon - Male 3.
>would, but wallflower
silolliallik - Male 3.
>extremely ugly
axemented - Male 3.
>has a wife
Male nym - Male 3.
>would but who?
oni - Male 1.
>would, cutie
funkyfrank - Male 3.
>lol
darius - Male 3.
>lol
jean - Male 1.
>would, cute!
senny - Male 2.
>would, but who?
ginga - Male 1.
>ugly admiral cap and sex pest behavior
Anonymous No.538043532 >>538043617 >>538043790 >>538046190
>>538042518
Why am I always the first one to be thrown into the "has a date" category?
I don't
Anonymous No.538043598
I don't do e-dating, sorry ladyboys.
Anonymous No.538043617 >>538043915
>>538043532
>Kenzou trying to act stupid like he doesn’t have screenshots with 12 girls
you kabedon’d izuna bro
Anonymous No.538043648 >>538043948
POST LOGS POST LOGS POST LOGS
Anonymous No.538043673
>>538042518
>Isa has a date
I'm killing myself.
Anonymous No.538043790
>>538043532
Oh were the Kenologists right? The mating ritual with Mr. Nigger marked the end of the 4-6 week long relationship.
Anonymous No.538043872 >>538044030
>>538042518
there is unironically only 2 males in that first list i wouldn’t mind being seen next to in public
the rest are horribly ugly in appearance or personality or are wallflowers
Anonymous No.538043915 >>538044063
>>538043617
But I like taking pictures with others, it's a lot of fun and this game had a great camera system
It's way crazier to me that you guys would even consider I'm dating someone over taking pictures
Anonymous No.538043947
post the parse
Anonymous No.538043948
>>538043648
Don't post logs, I got loading screens!
Anonymous No.538044030
>>538043872
>horribly ugly in appearance or personality or are wallflowers
I'm 3 of these
Anonymous No.538044063 >>538044715 >>538044750
>>538043915
you don’t have to date someone to bring a date bro
just ask one of the hoes in your back pocket to be a +1 and have a good time
im going with a purely platonic friend but we’ll hold hands and pretend like we’re dating
Anonymous No.538044183
POST THE PARSE
Anonymous No.538044328
Shut the fuck up Kyoppi no one was parsing
Anonymous No.538044406 >>538044873 >>538050450
>males can't even get a date
>futas have entire harems
grim
Anonymous No.538044516
>kenzou of all people don’t have a date for the meetup
that’s… that’s depressing
Anonymous No.538044545
>>538042518
I don't have a date tho...I might not even be able to attend sadly.
Anonymous No.538044714
I don't have a date
I will go alone
I will wallflower
I will be made fun of
Anonymous No.538044715
>>538044063
> im going with a purely platonic friend but we’ll hold hands and pretend like we’re dating


>”just playing” I say after sharing a tender kiss in the moonlight
>”pranked” I whisper as his hands slide up my skirt and wrap around my cock
>”sike” I laugh as I pull out after the creampie, still connected by ropes of swinging jizz
Anonymous No.538044726
Kenzou in my eyes is as dateable as they come, I just wish I had a legacypussy for him to make use of, I could never be the woman he deserves. Please guys, don't let Kenzou go alone....
Anonymous No.538044750 >>538045017
>>538044063
The whole date thing was added by others, I have no issue with it but the main point is for people to gather and take pictures together, the reason why I choose Saturday instead of Sunday is to allow others to make their own plans for the last day, be it with friends or a significant other
I don't know if I'll bring a date or not, I just want people to have a good time and the fact that they announced the fireworks for 1 hour after the meetup starts its such great timing as well
Anonymous No.538044873 >>538046131
>>538044406
the first part is true proofs for the 2nd part?
Anonymous No.538045017 >>538045650 >>538045908
>>538044750
the date is entirely optional but considering you will be caught on camera and forced to name change to escape the shame if you’re there alone, and everyone else is in pairs; it’s time to find someone
this is a good incentive to get anons to reach out and socialize and make friends before CBT ends too
Anonymous No.538045047 >>538045652
If I wasn't taken already, I'd have a ridiculous crush on creep
Anonymous No.538045113 >>538045274 >>538045291
I will also be attending alone. There is no love for my min height t2
Anonymous No.538045274 >>538045883
>>538045113
>im so alone nobody wants me
>never posts ign
s-sugoi
Anonymous No.538045291
>>538045113
if you care about attentionmaxing then you have to play a minheight f1 and paypig $100 for the hairstyles and outfits even though you lose $50 of that money spent
Anonymous No.538045404 >>538045470 >>538045695
The most important thing is to ask someone. Hypocritically, I will not be doing so, but that is because I don't know whether or not anyone has begun to hate me.
Anonymous No.538045470 >>538045518 >>538045639
>>538045404
Go with me Lico
Anonymous No.538045518 >>538045659
>>538045470
Lico already has a date LMAO
Anonymous No.538045639
>>538045470
I am not Lico. I also believe Lico has a date.
Anonymous No.538045650 >>538045829
>>538045017
There's also a lot that don't want to go through that too, that's kind of what makes me want to go solo, if the organizer doesn't get a date and goes alone that makes him a loser according to the thread narrative
But if I still have a good time, it should matter, every anon that wants to attend should, regardless of dates
Anonymous No.538045652 >>538045758
>>538045047
no you wouldn't
Anonymous No.538045659
>>538045518
No she doesn't
Anonymous No.538045682 >>538045838 >>538045870
why do 9 of 10 people in /vg/ generals that i make friends with always end up the type of person that gets bored of me after a week of lovebombing me and then they never talk to me again
Anonymous No.538045695 >>538045759
>>538045404
yes we hate you now auti
Anonymous No.538045758
>>538045652
creep...
Anonymous No.538045759
>>538045695
But we love Auti here
Anonymous No.538045817 >>538058516 >>538059614
Why not just go alone and have fun anyways?
Anonymous No.538045829
>>538045650
i want to take photos of you and izuna on the balcony against a backdrop of starry sky and fireworks though
Anonymous No.538045838
>>538045682
because you are boring and they found someone better
Anonymous No.538045863
I know who Auti actually is so I don't like them
Anonymous No.538045870
>>538045682
because you go for the obvious sluts
Anonymous No.538045883 >>538046093 >>538046248
>>538045274
Sometimes it's better to stay mysterious and unidentifiable
Anonymous No.538045908
>>538045017
This anon smells of mental illness
Anonymous No.538046020 >>538046180
>Maku already in the acceptance phase
I’m sorry bro.
Anonymous No.538046053
the meetup is going to suck btw because it's too out in the open, there will be a massive amount of normies that flock in
Anonymous No.538046093 >>538046294
>>538045883
I need to know who you are NOW
Anonymous No.538046131 >>538048241
>>538044873
its in the pso2g discord
Anonymous No.538046164
>>537994254 (OP)
Which channel is this meetup in?
Anonymous No.538046180 >>538053558
>>538046020
Just like have fun.
Anonymous No.538046190
>>538043532
How long did you e-date chooby
Anonymous No.538046248
>>538045883
This is one of
>Fely
>Scoozy
>Azyrea
>Cylfina

if you’re azyrea dm me right now
Anonymous No.538046252 >>538046432 >>538046521 >>538048527
come dance
Anonymous No.538046294 >>538046495
>>538046093
Nope. I will remain a secret.
Anonymous No.538046432 >>538046474
>>538046252
no sorry i'm gooning in vc
Anonymous No.538046474 >>538046661 >>538053825
>>538046432
shut the fuck up Mofu
Anonymous No.538046495 >>538046681
>>538046294
Yeah but I want to be your friend, who has a cock.
Anonymous No.538046521
>>538046252
Coconut was hotter with the black bikini
Anonymous No.538046661
>>538046474
don't know who that is
Anonymous No.538046681 >>538047114
>>538046495
Many people here have cocks
Anonymous No.538046693
coconut lowkey one of the most generic female type 1s i done ever seen
someone post the full collage
Anonymous No.538046731 >>538046886
where are the black anons?
Anonymous No.538046883
>Anons talking about having dates with other players
I WILL download the game on my phone
I WILL play simultaneously with my cute t3 F on pc and my handsome t2 M on mobile
I WILL make them a couple and have them pose and take pics together

And (you) will not stop me
Anonymous No.538046886 >>538046975 >>538047343
>>538046731
miyu is still picking bananas
Anonymous No.538046887
You can tell Coconut is not a biofem because her MMO characters are ugly
Anonymous No.538046975 >>538047040 >>538047146
>>538046886
I will befriend miyu. I want to talk to other hard hittin niggas
Anonymous No.538047034
Does Miyu have a date for Saturday? Can someone confirm.
Anonymous No.538047040 >>538048354
>>538046975
are they hard pipe hittin' niggas? :3
Anonymous No.538047083
>>538043369
So true, I hope people leave me alone and don't ask for a date. I don't want to reject anyone but I also don't want to go out with anyone, I'll enjoy the fireworks by myself.
also I'm a type 2, not 3
Anonymous No.538047114 >>538048074
>>538046681
Ye, but mines big
Anonymous No.538047146 >>538048169
>>538046975
i can log on if you want me to.. i was just playing trails in the sky
Anonymous No.538047251
it’s looking more and more like we’ll have unironic single anons at the firework date
Anonymous No.538047343
>>538046886
DAAAAAAAAAAY OH
DAAAAAAAAAAAAAAAAAY OH
DAYLIGHT COMES AND ME WANGO HOME~
Anonymous No.538047394 >>538047617
>>538042518
i don't have a date
Anonymous No.538047617 >>538048289
>>538047394
creep?
Anonymous No.538048074 >>538049851
>>538047114
How big?
Anonymous No.538048121 >>538048183 >>538048229
You guys are trying really hard to force this couples shit
Anonymous No.538048169
>>538047146
I'm at work. I'll bug you if I see you online later in like 2-3 hours.
Anonymous No.538048183
>>538048121
Yeah
Anonymous No.538048229
>>538048121
They do it in every /vg/ MMO thread, it's kinda creepy
Anonymous No.538048241 >>538050450
>>538046131
not in it just leak it or sybau
Anonymous No.538048289
>>538047617
i won't say cause i'm embarrassed.
Anonymous No.538048354
>>538047040
only the meanest niggas on the O'block
Anonymous No.538048527
>>538046252
>Mute game music
>Play CHIC - Everybody Dance.mp3
Yep, it's dancin' time
Anonymous No.538048672
YOU DONT have to go with a date
But you can and it is ENCOURAGED given the romantic nature of the event
Anonymous No.538048713
me? i'm gonna find a date at the event
Anonymous No.538048724
im going alone and sitting in the corner by myself
Anonymous No.538048751
I don't think I'll have enough time to unlock the armband outfit in the beta.
At least I got it to blue.
Anonymous No.538048872 >>538049163
C rank f3 here, who wants to go with me tomorrow??
Anonymous No.538048894 >>538049190
I'll just stand alone and hope someone approaches my min height t2. Maybe I'll even do a few dance moves.
Anonymous No.538048939 >>538049062 >>538049075
this is literally /xivg/ and /pso2g/ in every essence but with a worse game that has worse graphics and no modding like either ffxiv or pso2ngs
Anonymous No.538049003 >>538049092
What dance number is this
Anonymous No.538049062
>>538048939
>no modding
The main reason I like it
Anonymous No.538049070 >>538049250 >>538049294 >>538050597 >>538050790 >>538050796 >>538051393 >>538051602 >>538051915 >>538053459
Lets fix this once and for all
Roll your date for the meetup
Anonymous No.538049075 >>538049134
>>538048939
with the addition of general/clique wars so it's even worse
Anonymous No.538049092
>>538049003
thug shaker 5
Anonymous No.538049134 >>538049198 >>538049314 >>538050295
>>538049075
>with the addition of general/clique wars so it's even worse
do MMOs always start with clique wars like this?
Anonymous No.538049143 >>538049325 >>538049392 >>538049559
>>537990163

Remember.
Most anons already added their roommate on discord.
Most are already asking them to date.
Don’t. Let. This. CBT. Period. Be. A. Waste

this is an UNPARALLELED time of exclusivity and intimacy with a small pool of active players

when the game launches YOU WILL BE COMPETING WITH 4 GUILDS OF PEOPLE AND THE COZY YOTSUBA GUILD YOU ONCE KNEW WILL CEASE TO EXIST

YOUR CRUSH MAY NOT EVEN RETURN

DO NOT LET THIS OPPORTUNITY GO TO WASTE.
GET. A. DATE.
Anonymous No.538049163 >>538049494
>>538048872
we can stand next to each other whilst being alone
Anonymous No.538049190
>>538048894
my wife scoozy
Anonymous No.538049198
>>538049134
No anon is an island. They all come with prior history based on earlier MMOs.
Anonymous No.538049250 >>538049483
>>538049070
gross
Anonymous No.538049294 >>538049385
>>538049070
how do i get it to pause
Anonymous No.538049314 >>538049572
>>538049134
it's literally just one person from a particular general shitposting
Anonymous No.538049325
>>538049143
I dont really care its just a game lol
Anonymous No.538049385
>>538049294
use snip and sketch or hit print screen
Anonymous No.538049391
Reminder that if you show up to meetup without a date and you're not in top 10 parses then you're a failure
Anonymous No.538049392 >>538050012
>>538049143
Okay lilpup you can stop trying to force this now.
Anonymous No.538049483 >>538049590 >>538049768 >>538050120
>>538049250
We can do it doggy-style so you don't have to see my face
Anonymous No.538049494 >>538049817
>>538049163
That sounds perfect! How will I know who you are though...
Anonymous No.538049559
>>538049143
stfu lico
Anonymous No.538049572 >>538049690
>>538049314
and who might your boogeyman be?
Anonymous No.538049590 >>538049746
>>538049483
i don't want to see your child body
Anonymous No.538049690
>>538049572
___(you)___
Anonymous No.538049746
>>538049590
You will be a lolicon by the end of the night~
Anonymous No.538049768
>>538049483
post butt
Anonymous No.538049817 >>538050207 >>538050828
>>538049494
my character looks like this: >>538040821
Anonymous No.538049820 >>538050224
damn anon rolled super slut and is complaining
Anonymous No.538049851 >>538049891
>>538048074
Bigger than 7.5
Anonymous No.538049891 >>538053375
>>538049851
how fat are you?
Anonymous No.538049895
>>538022232
Lots of lonely men play mmorpgs and lots of biological women enjoy the social aspects of mmorpgs so the lonely men who play mmorpgs seek the biological women who also play mmorpgs.
Anonymous No.538049969
does Noir have a date
Anonymous No.538050012
>>538049392
>t.datelet
Anonymous No.538050057 >>538050448
How do I unlock the emblem so I can start upgrading it?
Anonymous No.538050120 >>538050368
>>538049483
where are her breasts?
Anonymous No.538050180
Anonymous No.538050207 >>538050474
>>538049817
you wish
Anonymous No.538050224
>>538049820
rerolling is for dishonest faggots
Anonymous No.538050292
Don't reroll me aiiieeeee
Anonymous No.538050295
>>538049134
When this board was new no, but at this point every mmo general is 80-90% the same people that all already know eachother.
Anonymous No.538050368
>>538050120
Boys don't have breasts
Anonymous No.538050448 >>538050658
>>538050057
I think you just go kill mobs with a shadow orb on top.
Anonymous No.538050450 >>538050774 >>538051078 >>538051741 >>538051849 >>538051901 >>538054304 >>538054796 >>538055249
>>538044406
>>538048241
he was not lying... male bros...
Anonymous No.538050474 >>538050592
>>538050207
that's literally my character ingame though, the zilu picture is just there because i think she's cute...
Anonymous No.538050592 >>538050758
>>538050474
god i wish i could dress like this
Anonymous No.538050597 >>538050790
>>538049070
I'll have the NBA Y2K and the fried chicken ready.
Anonymous No.538050616 >>538050671
Why do you guys talk SO much about romance/dating. STOP IT! I don't wanna THINK about this kinda stuff it makes me all retarded and sad.
Anonymous No.538050625
I'm one of the biggest shitposter/schizo across multiple generals and people haven't caught on to who I am.
Anonymous No.538050658 >>538050781
>>538050448
Oh it just auto upgrades?
Anonymous No.538050671 >>538050862
>>538050616
It's fun
Anonymous No.538050701
It's purple.
Anonymous No.538050758 >>538051082
>>538050592
just do it
Anonymous No.538050774
>>538050450
sisters why didn't the popular gals join yotsuba... are we that undesirable???
Anonymous No.538050781
>>538050658
no
After you get the loot from them you need to go into the season interface and upgrade your things.
Anonymous No.538050790
>>538049070
>>538050597
Me too, better get my jays polished
Anonymous No.538050796
>>538049070
>2 replies
why aren’t you anons rolling i see you dancing like whores in guild hall
ROLL and you cannot reroll or not post your results
Anonymous No.538050828 >>538051058
>>538049817
Ok! I'll be on the lookout for you then.
Anonymous No.538050862
>>538050671
...Understandable I guess.
Anonymous No.538050958 >>538051069
big puffer!
Anonymous No.538051031
I need to come up with a different name for launch
Anonymous No.538051058
>>538050828
the name begins with a v if it helps, i look forward to wallflowering!
Anonymous No.538051069
>>538050958
you’re a forgettable background character in this season
Anonymous No.538051078
>>538050450
>all mid
safe
Anonymous No.538051082 >>538051452 >>538051639
reposting on request, still a work in progress, I wanna re-organize the skill tree path mainly

>>538050758
there's no fashion like that in game...
Anonymous No.538051393 >>538051737
>>538049070
>Don't even know who this is and have never talked to them.
It's over for me...
Anonymous No.538051452 >>538051615 >>538051682
>>538051082
ahh ingame, i meant irl
Anonymous No.538051602
>>538049070
hmm
Anonymous No.538051615 >>538051841
>>538051452
I would irl but I live in florida and it's much too hot for that...
Anonymous No.538051639 >>538052002
>>538051082
Is 67 the max points we can expect to get?
Anonymous No.538051682 >>538051841
>>538051452
How about you dress up like that irl?
Anonymous No.538051737
>>538051393
That’s Risa
Anonymous No.538051741 >>538051872
>>538050450
the popular girls clique was real? I thought you pso2g posters were making it up
Anonymous No.538051841 >>538052002 >>538052257
>>538051615
ahhh, maybe a portable fan would help a bit... try in winter, if it gets a bit colder!

>>538051682
i already do from time to time
Anonymous No.538051849
>>538050450
but wakaba irl is like some 5'6 SEA monkey (fat)
Anonymous No.538051858 >>538051969 >>538052941
He's here... I'm so wet suddenly... I'm getting cramps... I'm ready
Anonymous No.538051872
>>538051741
bro you are forcing this too hard
Anonymous No.538051901 >>538052043
>>538050450
who in this image does not have a date and wouldn’t mind going to the fireworks with a m2?
Anonymous No.538051915
>>538049070
Anonymous No.538051969
>>538051858
is it me
Anonymous No.538052002 >>538052465
>>538051639
no that's just the core tree path I personally think should be prioritized

>>538051841
maybe maybe...
Anonymous No.538052043 >>538052265
>>538051901
They are all dating the purple one sorry anon
Anonymous No.538052257 >>538052465
>>538051841
Now that sounds like a fun past time. What kinda clothes do you typically pick out?
Anonymous No.538052265
>>538052043
Red*
Anonymous No.538052369 >>538052476
How do I adjust autoplay to only use certain skills?
Anonymous No.538052465 >>538053130
>>538052002
i believe in you!

>>538052257
jirai kei rarely like mentioned and when i feel like it but usually a blend of either minimal styled elegance or cute dark black goth because i love wearing boots
Anonymous No.538052476
>>538052369
go to the options and click auto battle settings
Anonymous No.538052528 >>538052938
https://www.youtube.com/watch?v=MxekyGtqcNE
This general kinda fruity not gonna lie desu
Anonymous No.538052591 >>538052720
95% men.
Anonymous No.538052720
>>538052591
I'm the 5%!
Anonymous No.538052938 >>538053330
>>538052528
>This general kinda fruity not gonna lie desu
Anonymous No.538052941
>>538051858
I'm logging off.
Anonymous No.538052985 >>538053372
scoozy needs to log in and dance next to me right now
Anonymous No.538053130 >>538053424
>>538052465
Gothic clothes too huh? But now that I think about it, aren't you a boy...? You might be sending out mixed signals...
Anonymous No.538053206 >>538053372
Isa needs to come back to the guild center and dance next to me right now.
Anonymous No.538053330
>>538052938
I'm glad you got the joke, anon. Good boy.
Anonymous No.538053372
>>538052985
>>538053206
I'm shipping it
Anonymous No.538053375
>>538049891
500 lbs
Anonymous No.538053424 >>538054002
>>538053130
if having a penis makes me a boy then yeah...
Anonymous No.538053459 >>538053678
>>538049070
I think I'll just skip the meetup....
Anonymous No.538053464
Only biofems should be allowed to wear goth and jirai kei fashion
Anonymous No.538053558
>>538046180
thank you for the goat image, but in the end I was still made fun of for stepping out of my pictomancer circle.
Anonymous No.538053678
>>538053459
you have horrible rng
Anonymous No.538053825 >>538054868
>>538046474
Sorry, I don’t post cute girls.
I will just shamelessly avatarfag or straight up say it’s me.
That and I just woke up..
Anonymous No.538053918 >>538054034
Hello
Please stop namedropping me onegai desu
Thank you desu
Anonymous No.538054002 >>538054373
>>538053424
A boy wearing cute clothes, thats pretty taboo but now I kinda want to hear more about why you dress so girly. Could post my tag if you wanted to share some more...
Anonymous No.538054034
>>538053918
okay which one are you
Anonymous No.538054091 >>538054225 >>538054353
Isa and Kenzou dancing next to me spraying their musk everywhere... my ovaries won't be able to take it... It feels like I pissed myself...
Anonymous No.538054113
Hello
Please keep namedropping me onegai desu
Thank you desu
Anonymous No.538054225
>>538054091
i don't remember making this post
Anonymous No.538054304 >>538054796
>>538050450
Missing one cumrag
Anonymous No.538054353
>>538054091
whys a boy talking about his ovaries
Anonymous No.538054363
Why are boys wearing girls clothes?
Anonymous No.538054373 >>538055131
>>538054002
it's not that taboo, is it... cute fashion is universal and should be allowed for anyone!~ could always talk at that meetup happening otherwise, if nothing else :3
Anonymous No.538054405 >>538054587
Is it okay to date a spirit?
Anonymous No.538054587 >>538055051
>>538054405
Aren't you the redhead who was living with a dude and making hearts with him? Did he die/quit?
Anonymous No.538054775 >>538054854 >>538054864 >>538054875
Pls next thread I have some pics to post.
Anonymous No.538054796
>>538054304
>>538050450
This one is missing still
Anonymous No.538054854
>>538054775
We are not going to get to 750 any time soon. Post them.
Anonymous No.538054864
>>538054775
You can just post them now
Anonymous No.538054868 >>538055142
>>538053825
damn you’re a neet boyfailure too?
Anonymous No.538054875
>>538054775
just post them
Anonymous No.538054975
wtf is a boyfailure
Anonymous No.538055051 >>538055323
>>538054587
We're doing alright
Anonymous No.538055127 >>538055179 >>538055398
my male character is a boysuccess
Anonymous No.538055131 >>538055208
>>538054373
I'll be sure to be on the lookout for you then anon!
Anonymous No.538055142
>>538054868
Not really a neet since I still have to go out sometimes. I just nap a lot..
Sleep is fragmented so instead of getting a full 8 hours I’ll just nap like 4 times a day like a retard.
Anonymous No.538055168 >>538055305
Anyone wanna go with me?
Anonymous No.538055179
>>538055127
Based.
Anonymous No.538055208
>>538055131
i look forward to it :3
Anonymous No.538055249
>>538050450
AZRICE DON'T LOOK
Anonymous No.538055305 >>538055538
>>538055168
post that kpop demon hunters video and ill consider it
Anonymous No.538055323 >>538055749
>>538055051
Lets have sex. Your boyfriend can watch.
Anonymous No.538055398
>>538055127
shut the fuck up miki
Anonymous No.538055538 >>538055639 >>538056624
>>538055305
This one?
Anonymous No.538055626 >>538056549
>>537994326
>>Date and Time
>Saturday, 3PM-5PM PST. Line TBD.
this shit is so fucked for us europeans
Anonymous No.538055639 >>538058089
>>538055538
This is so silly lol. I love this song though.
Anonymous No.538055749
>>538055323
Sorry, I'd have to refuse that offer
Anonymous No.538055770
>>537994326
I work on that day so I guess my thread designated husband will be there by himself.
Anonymous No.538055967 >>538056005 >>538056108 >>538056758 >>538060327
Hello~
Anonymous No.538056005 >>538057695
>>538055967
can i cumtribute this
Anonymous No.538056108 >>538057695
>>538055967
Made for type 1 females
Anonymous No.538056291
I don't want to wait for launch. I want it now
Anonymous No.538056493 >>538057054
who the fuck works on Saturday 5pm PST
it’s the last CBT, call out you fucking bitch you have more important things
or we need a second meetup on Sunday
Anonymous No.538056549
>>538055626
It's saturday... you'd go out and have a life rather than suck 30yo boypussy?
Anonymous No.538056624 >>538058089
>>538055538
It's peak im afraid
Anonymous No.538056668 >>538056715 >>538056830
Does Butts ERP?
Anonymous No.538056692 >>538056912 >>538057027 >>538057072 >>538057486 >>538057624 >>538057932
does anyone want to meet up in another game after the cbt is over
Anonymous No.538056715 >>538057124
>>538056668
Nyes
Anonymous No.538056758 >>538057695
>>538055967
Made for bed breaking sex with T2 males
Anonymous No.538056790 >>538057079
my unlovable D tier f2 will be attending the meet up alone and have fun regardless!!! or instead I uninstall the beta tonight and save myself the humiliation..
Anonymous No.538056830 >>538057124 >>538057252
>>538056668
I hope you’re into QoS
Anonymous No.538056912 >>538057537
>>538056692
Yeah, meet me at the
Anonymous No.538057027 >>538057537
>>538056692
what games do you like
Anonymous No.538057054 >>538057257
>>538056493
>it’s the last CBT
please dont remind me....
Anonymous No.538057072 >>538057537
>>538056692
not really
Anonymous No.538057079
>>538056790
wallflower with the other loners standing at the outskirts
Anonymous No.538057124 >>538057252
>>538056715
>>538056830
Does she like type 1 females?
Anonymous No.538057252
>>538056830
Quality of service?
>>538057124
She loves me yes, so she's taken
Anonymous No.538057257
>>538057054
cute
Anonymous No.538057486 >>538057537
>>538056692
what games
Anonymous No.538057513 >>538057582 >>538057631
What if the game never releases
Anonymous No.538057537 >>538057679 >>538057696 >>538057842 >>538058032
>>538056912
>>538057027
>>538057072
>>538057486
ffxiv...
Anonymous No.538057582
>>538057513
This could be our last chance to... you know....
Anonymous No.538057624 >>538057876
>>538056692
Tera classique
Anonymous No.538057631
>>538057513
then we will be free from it's clutches until the next re-release
Anonymous No.538057679 >>538057876
>>538057537
You couldn't get me to resub to that kusoge
Anonymous No.538057695 >>538058275 >>538058524 >>538058610 >>538058749 >>538060327
>>538056005
>>538056108
>>538056758
!
Anonymous No.538057696 >>538057876
>>538057537
Hey, I also play that!
Anonymous No.538057842 >>538057876
>>538057537
oh, no thank you. i stopped playing that a long time ago.
Anonymous No.538057876 >>538057930 >>538057958 >>538058148 >>538058545
>>538057624
is tera even alive...

>>538057679
>>538057842
PLEASE COME BACK

>>538057696
do you like femra...
Anonymous No.538057930 >>538058095 >>538058181
>>538057876
why? im a femlala on xiv. no one likes them. i mean look at kyo
Anonymous No.538057932
>>538056692
sure, we can meet at the gathering hub for some hunts
Anonymous No.538057958 >>538058181
>>538057876
I sometimes am a femra..
Anonymous No.538058032
>>538057537
kys
what's your name
Anonymous No.538058043 >>538058108 >>538058114 >>538058184 >>538059538
Anonymous No.538058089
>>538055639
>>538056624
Glad you like it! Please enjoy this one too.
Anonymous No.538058095 >>538058142
>>538057930
people like normal ones
Anonymous No.538058108
>>538058043
>barely anyone compared to the last time
Anonymous No.538058114
>>538058043
>these are always taken when i'm not there
i hate this place
Anonymous No.538058142
>>538058095
im normal and not lewd at all so im irrelevant.
Anonymous No.538058148
>>538057876
No. That game hasn't moved at all, let alone move forward, in it's design since 2017. I like new MMOs because they have the chance to grow. Sure Star Resonance isn't perfect but it's could grow to be better. Xiv has had all the time in the world to do that and yet it didn't
Anonymous No.538058168
Anyone want there cock sucked? Meet me in the Quick Sands A.T
Anonymous No.538058181
>>538057930
femlalas are cute too tho...

>>538057958
i like other femra too a lot hi...
Anonymous No.538058184 >>538058338 >>538060470
>>538058043
this looks so bad since the BPM doesn't even match
Anonymous No.538058208 >>538058272
Where do I trade in life skills talent points to get more? It says I can trade in 300 stamina for 1 but no idea where?
Anonymous No.538058272 >>538058361
>>538058208
You get them by spending the stamina bwo
Anonymous No.538058275 >>538059561
>>538057695
Butts is so beautiful... I want to ask her if she wants to futa my type 1 female but I don't want to make things awkward between us...
Anonymous No.538058327 >>538058514
>xivgger spamming up his kusoge itt
we all and by we I mean WE and I mean I speak for everyone, WE ALL quit after endwalker
Anonymous No.538058338
>>538058184
you gotta feel the groove. the jive.
Anonymous No.538058361
>>538058272
oh I'm dumb tyty
Anonymous No.538058368 >>538058516
can someone show me maku's character
Anonymous No.538058514 >>538058680
>>538058327
>somehow still the fastest thread on /vg/
I don't think they quit bros
Anonymous No.538058516 >>538058785
>>538058368
>>538045817
Anonymous No.538058521 >>538058589
'ot 'layin 'inal 'tasy
Anonymous No.538058524 >>538059135 >>538059561
>>538057695
unironically one of the worst fem2/3s, there’s a reason your character was at the bottom of every tier list last night
Anonymous No.538058545 >>538059814
>>538057876
Tera is still alive. the big server we were all on will go back online soon and /vm/ is working on their own server currently
Anonymous No.538058589 >>538059064
>>538058521
Pygo and Miyu in their natural habitat
Anonymous No.538058610 >>538059561
>>538057695
let me smash already
Anonymous No.538058630 >>538058672
I'm posting my F3 without permission.
Anonymous No.538058672 >>538059193
>>538058630
*wiggles ur spear*
Anonymous No.538058680 >>538058827
>>538058514
It's 70% stale replies to anchorposts and tribal posts about their choice of in game race. Not even drama or anything. Just vapid posts sent into the void.
Anonymous No.538058749 >>538059561
>>538057695
DO YOU LIKE BOYS
Anonymous No.538058785
>>538058516
figures he's ugly
Anonymous No.538058827
>>538058680
There's always drama. It just moves too fast for anyone to care. That and most people know it's thread narrative.
Anonymous No.538058948 >>538059068 >>538059298
i will not be playing no vm tera pserver with eris, creep, coconut, ahoka, and towa, on everyone’s soul
Anonymous No.538059064 >>538059353
>>538058589
Wow it actually makes sense why this general was so shit
Anonymous No.538059068
>>538058948
I will if it has ninja
Anonymous No.538059087
>>538006778
You sound cute, I might keep an eye out
Anonymous No.538059135
>>538058524
He was on top of every list.
Anonymous No.538059193
>>538058672
*parries it and punishes you*
Anonymous No.538059248 >>538062660
>>538006778
>anon who wants a date puts themselves out there
>nobody DMs her
>replies calling her ugly

And this is why, as a wallflower, I never post my character. The C tiers last night already broke my heart.
Anonymous No.538059298 >>538059356 >>538059408 >>538059432 >>538059991
>>538058948
you forgot lico, allegreza, sura, paps, barossa, moonchaser, mei, isuzu, idclip, redo
stay cliqued out NERD
Anonymous No.538059353 >>538059476
>>538059064
You're welcome
Anonymous No.538059356 >>538059991
>>538059298
>sura
barf
Anonymous No.538059375 >>538059438 >>538059449 >>538059508 >>538059510 >>538059523 >>538059565 >>538059650 >>538059995 >>538060387
Tell me everything you know about Pygo
Anonymous No.538059408
>>538059298
>sura
nobody wants to play with that pretentious faggot sorry
Anonymous No.538059432
>>538059298
love alle
Anonymous No.538059438
>>538059375
They're in Yotsuba. You're welcome.
Anonymous No.538059449
>>538059375
Okay so you won't fucking believe this but basically they
Anonymous No.538059476 >>538059527
>>538059353
>Tfw shimapan is a dated trend now
Getting old sucks
Anonymous No.538059508
>>538059375
She needs to make another vocaroo wishing me goodnight.
Anonymous No.538059510
>>538059375
AND THEN THEY WERE LIKE
Anonymous No.538059523 >>538059589
>>538059375
Why don't you ask me in game
Anonymous No.538059527 >>538059629
>>538059476
shimapan is forever
Anonymous No.538059538
>>538058043
KINO
Anonymous No.538059561 >>538059918 >>538059932 >>538060327
>>538058275
>>538058524
>>538058610
>>538058749
!!
Anonymous No.538059565
>>538059375
whats even crazier than what the other anons said is that
Anonymous No.538059589 >>538059701
>>538059523
do u need a date for saturday
if yes ill whisper you right now
Anonymous No.538059614 >>538059734
>>538045817
why are you brown
Anonymous No.538059629
>>538059527
I wish it were so, anon...
Anonymous No.538059650
>>538059375
FAT FUCK
Anonymous No.538059701 >>538059779 >>538059791
>>538059589
I don't but thank you
Anonymous No.538059734 >>538059890
>>538059614
Anon, how old is your monitor?
Anonymous No.538059779 >>538059854 >>538060171
>>538059701
Who are you going with... is it seio? is it fucking seio....?
Anonymous No.538059791 >>538060171
>>538059701
>Pygo of all people has a fucking date
IM GOING TO DIE ALONE
Anonymous No.538059814
>>538058545
>Tera is still alive. the big server we were all on will go back online soon
which one? i kinda wanna play
Anonymous No.538059854
>>538059779
Keep her name OUT OF YOUR MOUTH!
*spits*
Anonymous No.538059890
>>538059734
I bought it second-hand in an ex-soviet country 6 years ago
Anonymous No.538059918 >>538066114
>>538059561
Do you want my type 1 female to futa you instead?
Anonymous No.538059932 >>538066114
>>538059561
Turn around
Anonymous No.538059991 >>538060237
>>538059298
>>538059356
do you mean tsuranova i remember him from maplestory 2 i loved erping with him on discord ngl
Anonymous No.538059995
>>538059375
I talked with pygo (first name basis btw we are just close like that) and she said she hates all of you
Anonymous No.538060171
>>538059791
Mogged

>>538059779
Wait and see ;)
Anonymous No.538060237 >>538060479
>>538059991
yes i know sura mentioned this to me yesterday about you
Anonymous No.538060327 >>538060420 >>538060454 >>538060460 >>538060468 >>538060504 >>538060514 >>538060573 >>538060612 >>538060780 >>538060937 >>538066114
>>538055967
>>538057695
>>538059561
Anonymous No.538060387
>>538059375
i think she's unironically taken and half of these posts are astroturfing
Anonymous No.538060420 >>538060505 >>538060573
>>538060327
God I hope EMV doesn't play this.
Anonymous No.538060454
>>538060327
I'll never understand the fascination with ham planet proportions. Those looks terrible.
Anonymous No.538060460
>>538060327
Extremely based from butts desu
Anonymous No.538060468
>>538060327
damn this game is ugly
Anonymous No.538060470 >>538060697
>>538058184
>/pso2/ggers caviling when anon posts something fun instead of discord screenshots or drama
Anonymous No.538060479
>>538060237
wtf no... stop lying...
Anonymous No.538060504
>>538060327
why are you leaking logs?
Anonymous No.538060505
>>538060420
He's in the thread shitposting and posting AI sloppa.
Anonymous No.538060514
>>538060327
Damn he roasted that crackhead
Anonymous No.538060573 >>538060681
>>538060327
based

>>538060420
he'd get filtered by the timegating and the gacha and the chat
Anonymous No.538060612
>>538060327
>people with shit like this on their computers are the ones telling you who's sane enough to talk to
Ermmmm
Anonymous No.538060681 >>538060884
>>538060573
Chat is only a problem cause of the lack of word wrapping and the controls to change channel.
Anonymous No.538060697
>>538060470
updoots to the left
Anonymous No.538060754
>>538060714
>>538060714
>>538060714
migrate when comfy
Anonymous No.538060774
is pso2 or bp better when it comes to chat and screenshotting
Anonymous No.538060780 >>538061321
>>538060327
>im sorry I made that horse photoshop
What?
Anonymous No.538060884
>>538060681
The chat honestly isn't that terrible compared to other games, and erp is doable.
It'd still help filter him tho because emv is a dumb crackhead
Anonymous No.538060937
>>538060327
My favorite t1 is in this picture. :)
Anonymous No.538061321
>>538060780
It was actually a shitty mspaint drawing of butts with a horse head
Anonymous No.538062660
>>538059248
Auti..
Anonymous No.538066114 >>538066954
>>538059918
>>538059932
>>538060327
!!!
Anonymous No.538066954
>>538066114
need you to milk me dry again,,,